Coordination sphere of Ca2+. We determined ?the number of water molecules

Coordination sphere of Ca2+. We determined ?the number of water molecules in a distance of 3.4 A to the Gracillin chemical information calcium ion, the maximum distance between the calcium ion and a water molecule in the first coordination sphere according to Plazinski et al. [28]. To check for intramolecular interactions, we calculated the minimum distance between the atoms of both domains using the g_mindist program of the Gromacs package.buffer consisting of 20 mM Tris, 500 mM NaCl, pH 7.4 was used to remove unspecifically bound proteins from the column. A buffer consisting of 20 mM Tris, 150 mM NaCl, 10457188 70 mM EDTA, pH 7.4 was used to remove potentially bound Ca2+ ions from the metal ion binding sites of the Parvalbumin domain. Another buffer consisting of 20 mM Tris, 150 mM NaCl, 0.2 mM ATP, pH 7.4 was used to remove potentially bound bacterial chaperones. Elution was performed using 20 mM Tris, 150 mM NaCl, 20 mM glutathione, pH 7.4. Eluted fusion protein was concentrated and glutathione was removed via dialysis using a 30 kDa MWCO centricon (Millipore) by repeated centrifugation and refilling of the centricon. Afterwards, cleavage with PreScission protease was performed at 4uC over night. Zarvin was purified by first removing GST via a 20 ml GSTrap column. The flow-through was collected and concentrated again. Gelfiltration using a Superdex 75 26/60 column (GE Healthcare) was performed to remove aggregates and degraded protein. The buffer used for GST MedChemExpress Anlotinib removal as well as for gel filtration contained 20 mM Tris, 150 mM NaCl, pH 7.4. Purified protein was aliquoted, shock frozen and stored at 220uC. The D72C 1315463 mutant of Zarvin and the separate Parvalbumin domain were purified in the same way, however 1 mM DTT was added to all buffers for purification of Zarvin-D72C. The separate Z domain was also purified as GST fusion protein, only missing the washing step with EDTA. Due to the architecture of the PreScission cleavage site the two amino acids GP remain at the N terminus of the protein.MALDI-MSProteins were desalted using Supel-Tips C18 (Sigma) and eluted with 50:50 (v/v) acetonitrile: 0.1 TFA in water. Matrix solution was prepared by dissolving 7.6 mg 29,59-dihydroxy acetophenone in ethanol and adding 125 ml of a solution containing 18 mg/ml di-ammonium hydrogen citrate in water. Proteins were spotted on a Ground steel target plate (Bruker Daltonics) using the dried droplet method. For that, 2 TFA in water were mixed with the desalted protein and matrix solution in a ratio of 1:1:1 (v/v). The spot was dried at room temperature. Mass analysis was carried out using an Autoflex speed MALDI-TOF (Bruker Daltonics).Cloning and ExpressionThe gene encoding the two-domain protein Zarvin was commercially synthesised and subcloned in a derivative of a pET41b expression vector containing GST and a PreScission cleavage site, both located N-terminal of the multiple cloning site (Geneart, Regensburg, Germany). The cloning sites used were ApaI and BamHI. The single Z- and Parvalbumin-domains were subcloned in the same vector by first amplifying the respective genes from the full length construct via PCR. The primers used for Z domain subcloning were 59 CACACAGGGCCCGTGGATAACAAATTTAACAAAGAACAGC-39 for forward ApaI cloning and 59 GGTTGGGGATCCATTATTTCGGCGCCTGCGCATCGT 39 for reverse BamHI cloning. The primers used for rat S55D/E59D-alpha-Parvalbumin subcloning were 59 CACACAGGGCCCAGCATGACCGATCTGCTGAGCGC 39 for forward ApaI cloning and 59 GGTTGGGGATCCATTAGCTTTCCGCCACCAGGG 39 for reverse B.Coordination sphere of Ca2+. We determined ?the number of water molecules in a distance of 3.4 A to the calcium ion, the maximum distance between the calcium ion and a water molecule in the first coordination sphere according to Plazinski et al. [28]. To check for intramolecular interactions, we calculated the minimum distance between the atoms of both domains using the g_mindist program of the Gromacs package.buffer consisting of 20 mM Tris, 500 mM NaCl, pH 7.4 was used to remove unspecifically bound proteins from the column. A buffer consisting of 20 mM Tris, 150 mM NaCl, 10457188 70 mM EDTA, pH 7.4 was used to remove potentially bound Ca2+ ions from the metal ion binding sites of the Parvalbumin domain. Another buffer consisting of 20 mM Tris, 150 mM NaCl, 0.2 mM ATP, pH 7.4 was used to remove potentially bound bacterial chaperones. Elution was performed using 20 mM Tris, 150 mM NaCl, 20 mM glutathione, pH 7.4. Eluted fusion protein was concentrated and glutathione was removed via dialysis using a 30 kDa MWCO centricon (Millipore) by repeated centrifugation and refilling of the centricon. Afterwards, cleavage with PreScission protease was performed at 4uC over night. Zarvin was purified by first removing GST via a 20 ml GSTrap column. The flow-through was collected and concentrated again. Gelfiltration using a Superdex 75 26/60 column (GE Healthcare) was performed to remove aggregates and degraded protein. The buffer used for GST removal as well as for gel filtration contained 20 mM Tris, 150 mM NaCl, pH 7.4. Purified protein was aliquoted, shock frozen and stored at 220uC. The D72C 1315463 mutant of Zarvin and the separate Parvalbumin domain were purified in the same way, however 1 mM DTT was added to all buffers for purification of Zarvin-D72C. The separate Z domain was also purified as GST fusion protein, only missing the washing step with EDTA. Due to the architecture of the PreScission cleavage site the two amino acids GP remain at the N terminus of the protein.MALDI-MSProteins were desalted using Supel-Tips C18 (Sigma) and eluted with 50:50 (v/v) acetonitrile: 0.1 TFA in water. Matrix solution was prepared by dissolving 7.6 mg 29,59-dihydroxy acetophenone in ethanol and adding 125 ml of a solution containing 18 mg/ml di-ammonium hydrogen citrate in water. Proteins were spotted on a Ground steel target plate (Bruker Daltonics) using the dried droplet method. For that, 2 TFA in water were mixed with the desalted protein and matrix solution in a ratio of 1:1:1 (v/v). The spot was dried at room temperature. Mass analysis was carried out using an Autoflex speed MALDI-TOF (Bruker Daltonics).Cloning and ExpressionThe gene encoding the two-domain protein Zarvin was commercially synthesised and subcloned in a derivative of a pET41b expression vector containing GST and a PreScission cleavage site, both located N-terminal of the multiple cloning site (Geneart, Regensburg, Germany). The cloning sites used were ApaI and BamHI. The single Z- and Parvalbumin-domains were subcloned in the same vector by first amplifying the respective genes from the full length construct via PCR. The primers used for Z domain subcloning were 59 CACACAGGGCCCGTGGATAACAAATTTAACAAAGAACAGC-39 for forward ApaI cloning and 59 GGTTGGGGATCCATTATTTCGGCGCCTGCGCATCGT 39 for reverse BamHI cloning. The primers used for rat S55D/E59D-alpha-Parvalbumin subcloning were 59 CACACAGGGCCCAGCATGACCGATCTGCTGAGCGC 39 for forward ApaI cloning and 59 GGTTGGGGATCCATTAGCTTTCCGCCACCAGGG 39 for reverse B.