N miRNA target sequence into the 39-UTR of reporter genes and

N miRNA target sequence into the 39-UTR of reporter genes and containing two independent expression cassettes encoding Gaussia Have been made in understanding the function and regulation of PKM luciferase (Gluc) and firefly luciferase (Fluc). Using the Asensors, miRNA activity can be inferred by measuring the inhibition of reporter gene expression. In this study, the real-time miRNA activity of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 in three PDAC cell lines (BxPC-3, CFPAC-1, SW1990), one pancreatic epithelioid carcinoma (PANC-1), and human pancreatic nestin-expressing cells without causing cancerassociated changes (hTERT-HPNE) was monitored using their corresponding Asensors. Most previous research is consistent with the results reflected by the Asensors, yet Title Loaded From File Asensors provided new insights for some miRNAs, which may be important for worldwide miRNA research.Monitoring of miRNAsPreliminary experiments showed that 10,000 cells infected by 108 copies of Asensors was the best ratio for monitoring miRNA activity in target cells and was applied in the following experiments. Cells were seeded in a 96-well cell culture plate (200 ml of recommended culture medium for each cell line) one day before infection. After infection with the Asensors, the target cells were further incubated for 3 days, and on each day, 20 ml of supernatant was sampled to detect Gluc, and 20 ml of culture medium was refilled to keep 200 ml of total culture medium. On day 3, cells were lysed to quantify the Fluc internal control.Assays of Fluc and Gluc ActivityThe Gluc and Fluc assay kits were purchased from New England Biolabs (Ipswich, MA, USA) and Promega (Madison, WI, USA), respectively. Cells in the 96-well plates were spun down, and a 20 ml aliquot of the cell-free medium in each well was taken for Gluc activity assays at 24, 48, and 72 hours. Substrate solution (50 ml per well) of Gluc was added into the sample. For Fluc activity, 20 ml of cell lysate per well was added to the substrate solution (100 ml per well) of Fluc. Both Fluc and Gluc expression was then tested using a luminometer (ModulusTM, Tuner BioSystems). The levels of Fluc and Gluc activity were quantified using relative light units (RLU).Materials and Methods miRNA Asensor ConstructionAll Asensors were purchased from FivePlus Molecular Medicine Institute (Beijing, China). The miRNA Asensor array was established as previously reported [11]. The miRNA Asensor plasmid was constructed based on the AAV vector plasmid pAAV2neo and contained two independent expression cassettes encoding Fluc and Gluc [12]. The former was used to calibrate the transduction efficiency, while the latter, which included a miRNA perfect complementary target sequence in the 39-UTR of Gluc, was used to monitor miRNA activity. A synthetic poly(A) signal/ transcriptional pause site was inserted between the two expression cassettes and reduced the effects of spurious transcription on the Fluc reporter gene expression. miR-200a, -200b, -21, -96, -146a, 10a, -155, and -221 sensor plasmids were constructed by inserting one copy of the corresponding miRNA target sequence, miR-200a (UAACACUGUCUGGUAACGAUGU), miR-200b (UAAUACUGCCUGGUAAUGAUGA), miR-21 (UAGCUUAUCAGACUGAUGUUGA), miR-96 (UUUGGCACUAGCACAUUUUUGCU), miR-146a (UGAGAACUGAAUUCCAUGGGUU), miR-10a (UACCCUGUAGAUCCGAAUUUGUG), miR-155 (UUAAUGCUAAUCGUGAUAGGGGU), or miR-221 (AGCUACAUUGUCUGCUGGGUUUC), into the 39-UTR of Gluc. They were then packaged into recombinant AAVs termed miRNA Asensors. The Asensor lacking the miRNA target sequence was u.N miRNA target sequence into the 39-UTR of reporter genes and containing two independent expression cassettes encoding Gaussia luciferase (Gluc) and firefly luciferase (Fluc). Using the Asensors, miRNA activity can be inferred by measuring the inhibition of reporter gene expression. In this study, the real-time miRNA activity of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 in three PDAC cell lines (BxPC-3, CFPAC-1, SW1990), one pancreatic epithelioid carcinoma (PANC-1), and human pancreatic nestin-expressing cells without causing cancerassociated changes (hTERT-HPNE) was monitored using their corresponding Asensors. Most previous research is consistent with the results reflected by the Asensors, yet Asensors provided new insights for some miRNAs, which may be important for worldwide miRNA research.Monitoring of miRNAsPreliminary experiments showed that 10,000 cells infected by 108 copies of Asensors was the best ratio for monitoring miRNA activity in target cells and was applied in the following experiments. Cells were seeded in a 96-well cell culture plate (200 ml of recommended culture medium for each cell line) one day before infection. After infection with the Asensors, the target cells were further incubated for 3 days, and on each day, 20 ml of supernatant was sampled to detect Gluc, and 20 ml of culture medium was refilled to keep 200 ml of total culture medium. On day 3, cells were lysed to quantify the Fluc internal control.Assays of Fluc and Gluc ActivityThe Gluc and Fluc assay kits were purchased from New England Biolabs (Ipswich, MA, USA) and Promega (Madison, WI, USA), respectively. Cells in the 96-well plates were spun down, and a 20 ml aliquot of the cell-free medium in each well was taken for Gluc activity assays at 24, 48, and 72 hours. Substrate solution (50 ml per well) of Gluc was added into the sample. For Fluc activity, 20 ml of cell lysate per well was added to the substrate solution (100 ml per well) of Fluc. Both Fluc and Gluc expression was then tested using a luminometer (ModulusTM, Tuner BioSystems). The levels of Fluc and Gluc activity were quantified using relative light units (RLU).Materials and Methods miRNA Asensor ConstructionAll Asensors were purchased from FivePlus Molecular Medicine Institute (Beijing, China). The miRNA Asensor array was established as previously reported [11]. The miRNA Asensor plasmid was constructed based on the AAV vector plasmid pAAV2neo and contained two independent expression cassettes encoding Fluc and Gluc [12]. The former was used to calibrate the transduction efficiency, while the latter, which included a miRNA perfect complementary target sequence in the 39-UTR of Gluc, was used to monitor miRNA activity. A synthetic poly(A) signal/ transcriptional pause site was inserted between the two expression cassettes and reduced the effects of spurious transcription on the Fluc reporter gene expression. miR-200a, -200b, -21, -96, -146a, 10a, -155, and -221 sensor plasmids were constructed by inserting one copy of the corresponding miRNA target sequence, miR-200a (UAACACUGUCUGGUAACGAUGU), miR-200b (UAAUACUGCCUGGUAAUGAUGA), miR-21 (UAGCUUAUCAGACUGAUGUUGA), miR-96 (UUUGGCACUAGCACAUUUUUGCU), miR-146a (UGAGAACUGAAUUCCAUGGGUU), miR-10a (UACCCUGUAGAUCCGAAUUUGUG), miR-155 (UUAAUGCUAAUCGUGAUAGGGGU), or miR-221 (AGCUACAUUGUCUGCUGGGUUUC), into the 39-UTR of Gluc. They were then packaged into recombinant AAVs termed miRNA Asensors. The Asensor lacking the miRNA target sequence was u.